| indep conf | exon | official id | type | nuc change | aa change | effect | mut/poly status | method used to determined mut/poly status | reference index | inheritance | region linked to | detection method | patient id | comments | |
| 1 | TSC2-47 | point | 52A>T | 12K>X | nonsense | mutation | 13 | familial | T3770 | small family | |||||
| intron 1 | TSC2-13 | point | 156+1G>A | splicing | mutation | 6 | sporadic | 1751 | parents not available for testing | ||||||
| c | intron 1 | TSC2-13 | point | 156+1G>A | splicing | mutation | 21 | sporadic | SSCP | 1751S | |||||
| intron 1 | TSC2-121 | point | 156+1G>A | splicing | mutation | 24 | familial | SSCP | F12-01 | ||||||
| intron 1 | TSC2-151 | point | 156+1G>A | splicing | mutation | 25 | familial | ASO,SSCP | T1328 | mosaic | |||||
| 3 | TSC2-74 | point | 273C>T | 85V | silent | polymorphism | 21 | unknown | unknown | published as 273T>C, Val85; nucleotides transposed | |||||
| 3 | TSC2-75 | point | 298C>A | 94P>T | missense | polymorphism | 21 | unknown | unknown | observed in unaffected controls, reported as 298A>C,Thr94Pro, nucleotides transposed | |||||
| 3 | TSC2-76 | point | 327T>G | 103A | silent | polymorphism | 21 | unknown | unknown | ||||||
| 4 | TSC2-152 | point | 483C>G | 155Y>X | nonsense | mutation | 20 | unknown | HD,SSCP | 341 | |||||
| 4 | TSC2-153 | insertion | 485-489insNNNNN | 156L-FS-X in 3'UTR | frameshift | mutation | 20 | unknown | HD,SSCP | 291 | |||||
| 4 | TSC2-154 | point | 496C>G | 160L>V | missense | polymorphism | 20 | unknown | HD,SSCP | group | |||||
| intron 4 | TSC2-155 | complex | [500-7C>A;500-6C>A] | complex change | polymorphism | 20 | unknown | HD,SSCP | group | ||||||
| intron 4 | TSC2-156 | point | 500-3C>T | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | 5-10% | |||||
| 5 | TSC2-99 | deletion | 505-506delTT | 163F-FS-X early at 187 | frameshift | mutation | 23 | unknown | SSCP | TS94-35 | |||||
| 5 | TSC2-157 | deletion | 546delC | 176F-FS-X early at 181 | frameshift | mutation | 20 | unknown | HD,SSCP | 46 | |||||
| 7 | TSC2-77 | point | 698G>A | 227C>Y | missense | mutation | 21 | sporadic | REF | 1512S | not seen in any controls | ||||
| 7 | TSC2-122 | point | 747C>G | 243L | silent | polymorphism | 24 | unknown | SSCP | unknown | published as 730C>G, off by one, freq 0.013 | ||||
| intron 7 | TSC2-158 | point | 793-1G>A | splicing | mutation | 20 | unknown | HD,SSCP | 246 | ||||||
| 8 | TSC2-159 | point | 799C>T | 261R>W | missense | polymorphism | 20 | unknown | HD,SSCP | group | unique | ||||
| 8 | TSC2-100 | insertion | 849insC | 277C-FS-X early at 337 | frameshift | mutation | 23 | unknown | SSCP | TS92-05 | |||||
| 9 | TSC2-160 | point | 874A>G | 286M>V | missense | polymorphism | 20 | unknown | HD,SSCP | group | <5% | ||||
| 9 | TSC2-48 | point | 889C>T | 291L | silent | polymorphism | 14 | unknown | SSCP | group | 1/60 chroms | ||||
| 9 | TSC2-101 | point | 893T>C | 292L>P | missense | mutation | 23 | unknown | SSCP | TS94-02 | |||||
| 9 | TSC2-161 | point | 899G>A | 294G>E | missense | mutation | 20 | familial | HD,SSCP | 278 | |||||
| 9 | TSC2-102 | insertion | 918-932insATGGCTCTCTGGGGA | 300insMALWG | in-frame insertion | mutation | 23 | unknown | SSCP | TS91-03 | 15bp duplication flanked by 2 short direct repeats of TGGG | ||||
| intron 9 | TSC2-123 | point | 994-1G>A | splicing | mutation | 24 | familial | SSCP | F11-01 | listed as exon 10, should be intron 9 | |||||
| 10 | TSC2-78 | point | 1011C>A | 331N>K | missense | mutation | 21 | sporadic | 1909S | not seen in any controls | |||||
| 10 | TSC2-79 | point | 1047C>T | 343T | silent | polymorphism | 21 | unknown | unknown | ||||||
| 10 | TSC2-162 | deletion | 1111-1113delATC | 365delI | in-frame deletion | mutation | 20 | sporadic | HD,SSCP | 60 | |||||
| 10 | TSC2-49 | deletion | 1112-1113delTC | 365I-FS-X early at 385 | frameshift | mutation | 14 | sporadic | SSCP | TSC-086 | |||||
| 10 | TSC2-163 | point | 1118G>A | 367R>Q | missense | polymorphism | 20 | unknown | HD,SSCP | group | <5% | ||||
| 10 | TSC2-80 | point | 1128G>A | 370Q | silent | polymorphism | 21 | unknown | unknown | published as 1128A>G, Gln370 (nucleotides transposed) | |||||
| 10 | TSC2-38 | point | 1128G>A | 370Q | silent | polymorphism | 10 | unknown | unknown | paper reports it as CAA >CAG, Q320, exon 10; so this is the most likely spot | |||||
| 10 | TSC2-164 | point | 1128G>A | 370Q | silent | polymorphism | 20 | unknown | HD,SSCP | group | <5%, reported transposed as 1128A>G | ||||
| 11 | TSC2-165 | point | 1151C>T | 378P>L | missense | polymorphism | 20 | unknown | HD,SSCP | group | unique | ||||
| 11 | TSC2-39 | deletion | 1160-1191delGGACCATCGTCCATGACCTGTTGACCACGGTG | 381R-FS-X early at 385 | frameshift | mutation | 10 | sporadic | PTT | 4 | creates new NciI site; results in the mutant exon 11 being spliced out to maintain exp of TSC2 | ||||
| 11 | TSC2-124 | point | 1161G>A | 381R | silent | polymorphism | 24 | unknown | SSCP | unknown | published as 1144G>A (off by one), freq 0.013 | ||||
| 11 | TSC2-125 | deletion | 1178-1185delTGTTGACC | 387L-FS-X early at 393 | frameshift | mutation | 24 | sporadic | SSCP | S11-01 | reported to stop early at 396, should be 393 | ||||
| 11 | TSC2-126 | point | 1237T>G | 407Y>D | missense | mutation | 24 | sporadic | SSCP | S13-01 | |||||
| intron 11 | TSC2-166 | point | 1275+2T>C | splicing | mutation | 20 | unknown | HD,SSCP | 24 | ||||||
| 12 | TSC2-63 | point | 1294C>T | 426L | silent | polymorphism | 17 | unknown | unknown | rare variant | |||||
| 12 | TSC2-64 | point | 1299C>A | 427I | silent | polymorphism | 17 | unknown | unknown | rare variant | |||||
| 12 | TSC2-167 | point | 1336G>A | 440G>S | missense | polymorphism | 20 | unknown | HD,SSCP | group | |||||
| 12 | TSC2-50 | point | 1365G>C | 449M>I | missense | mutation | 14 | familial | linked | chr16 | SSCP | TSC-028 | |||
| 12 | TSC2-127 | point | 1365G>C | 449M>I | missense | polymorphism | 24 | unknown | SSCP | unknown | reported by Wilson et al. as mutation, freq 0.013 | ||||
| 12 | TSC2-129 | point | 1366G>T | 450E>X | nonsense | mutation | 24 | familial | SSCP | F16-01 | |||||
| 12 | TSC2-128 | point | 1366G>T | 450E>X | nonsense | mutation | 24 | familial | SSCP | F17-01 | |||||
| 13 | TSC2-70 | point | 1390C>T | 458R>X | nonsense | mutation | 19 | familial | HOU-34 | germ-line mosaicism, reported +1 | |||||
| 13 | TSC2-168 | point | 1395C>T | 459G | silent | polymorphism | 20 | unknown | HD,SSCP | group | unique | ||||
| 13 | TSC2-169 | point | 1405A>G | 463I>V | missense | polymorphism | 20 | unknown | HD,SSCP | group | unique | ||||
| intron 13 | TSC2-3 | point | 1462-2A>T | splicing | mutation | 33bp deletion in RNA deletes aa 482-492 | 3 | familial | unknown | ||||||
| intron 13 | TSC2-4 | point | 1462-1G>T | splicing | mutation | 33bp deletion in RNA deletes aa 482-492 | 3 | familial | unknown | ||||||
| intron 13 | TSC2-170 | point | 1462-1G>A | splicing | mutation | 20 | unknown | HD,SSCP | 255 | ||||||
| 14 | TSC2-81 | point | 1475A>T | 486N>I | missense | mutation | 21 | sporadic | SSCP | 1513S | not seen in controls | ||||
| 14 | TSC2-82 | point | 1486A>G | 490I>V | missense | polymorphism | observed in unaffected control | 21 | unknown | unknown | |||||
| 14 | TSC2-171 | deletion | 1506delC | 496I-FS-X early at 534 | frameshift | mutation | 20 | unknown | HD,SSCP | 366 | |||||
| 14 | TSC2-51 | point | 1531C>T | 505R>X | nonsense | mutation | 14 | unknown | SSCP | TSC-037 | small family | ||||
| 14 | TSC2-103 | point | 1531C>T | 505R>X | nonsense | mutation | 23 | unknown | SSCP | TS94-96 | |||||
| 14 | TSC2-172 | point | 1531C>T | 505R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 100 | |||||
| 14 | TSC2-173 | point | 1531C>T | 505R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 159 | |||||
| 14 | TSC2-174 | point | 1531C>T | 505R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 173 | |||||
| 14 | TSC2-104 | deletion | 1595-1598delGCCT | 526S-FS-X early at 533 | frameshift | mutation | 23 | unknown | SSCP | TS87-144 | |||||
| 14 | TSC2-65 | point | 1596C>T | 526S | silent | polymorphism | 17 | unknown | unknown | ||||||
| 14 | TSC2-52 | point | 1596C>T | 526S | silent | polymorphism | 14 | unknown | SSCP | group | 1/60 chroms | ||||
| 14 | TSC2-5 | point | 1596C>T | 526S | silent | polymorphism | 3 | unknown | unknown | 24/163 people (15%) | |||||
| 14 | TSC2-40 | point | 1596C>T | 526S | silent | polymorphism | 10 | unknown | unknown | ||||||
| intron 14 | TSC2-130 | point | 1617+16C>T | non-coding | polymorphism | 24 | unknown | SSCP | unknown | reported as 1600+15C>T (off by one), freq 0.063 | |||||
| intron 14 | TSC2-175 | point | 1618-39C>T | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | 5-10% | |||||
| intron 14 | TSC2-176 | point | 1618-14C>T | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | 5-10% | |||||
| 15 | TSC2-83 | point | 1625C>T | 536A>V | missense | polymorphism | observed in unaffected control | 21 | unknown | unknown | |||||
| 15 | TSC2-41 | point | 1629C>T | 537R | silent | polymorphism | 10 | unknown | unknown | ||||||
| 15 | TSC2-42 | deletion | 1634delT | 539L-FS-X early at 560 | frameshift | mutation | 10 | sporadic | PTT | 3 | |||||
| intron 15 | TSC2-177 | point | 1735-16C>T | non-coding | polymorphism | 20 | unknown | group | unique | ||||||
| 16 | TSC2-178 | point | 1765G>A | 583A>T | missense | polymorphism | 20 | unknown | HD,SSCP | group | |||||
| 16 | TSC2-179 | point | 1812C>G | 598Y>X | nonsense | mutation | 20 | unknown | HD,SSCP | 17 | |||||
| 16 | TSC2-180 | deletion | 1813delA | 599K-FS-X early at 697 | frameshift | mutation | 20 | unknown | HD,SSCP | 289 | |||||
| 16 | TSC2-71 | point | 1849C>T | 611R>W | missense | mutation | 19 | familial | HOU-37 | germ-line mosaicism, reported +1 | |||||
| 16 | TSC2-53 | point | 1849C>T | 611R>W | missense | mutation | 14 | unknown | SSCP | TSC-382 | small family | ||||
| 16 | TSC2-181 | point | 1849C>T | 611R>W | missense | mutation | 20 | unknown | HD,SSCP | 98 | |||||
| 16 | TSC2-182 | point | 1849C>T | 611R>W | missense | mutation | 20 | unknown | HD,SSCP | 208 | |||||
| 16 | TSC2-183 | point | 1849C>T | 611R>W | missense | mutation | 20 | sporadic | HD,SSCP | 217 | |||||
| 16 | TSC2-131 | point | 1850G>A | 611R>Q | missense | mutation | 24 | familial | SSCP | F03-01 | mother possibly somatic mosaic, results in elimination of MspI site | ||||
| 16 | TSC2-106 | point | 1850G>A | 611R>Q | missense | mutation | 23 | unknown | SSCP | TS93-29 | |||||
| 16 | TSC2-105 | point | 1850G>A | 611R>Q | missense | mutation | 23 | unknown | SSCP | TS94-31 | |||||
| 16 | TSC2-184 | point | 1850G>A | 611R>Q | missense | mutation | 20 | sporadic | HD,SSCP | 32 | |||||
| 16 | TSC2-185 | point | 1850G>A | 611R>Q | missense | mutation | 20 | unknown | HD,SSCP | 123 | |||||
| 16 | TSC2-186 | point | 1850G>A | 611R>Q | missense | mutation | 20 | unknown | HD,SSCP | 102 | |||||
| 16 | TSC2-187 | point | 1850G>A | 611R>Q | missense | mutation | 20 | unknown | HD,SSCP | 353 | |||||
| 17 | TSC2-188 | point | 1859C>A | 614A>D | missense | mutation | 20 | sporadic | HD,SSCP | 275 | |||||
| 17 | TSC2-84 | point | 1862T>C | 615F>S | missense | polymorphism | observed in unaffected controls | 21 | unknown | unknown | |||||
| 17 | TSC2-85 | point | 1878G>A | 620L | silent | polymorphism | 21 | unknown | unknown | ||||||
| 18 | TSC2-189 | deletion | 1993-1999delACCAGCG | 659T-FS-X early at 695 | frameshift | mutation | 20 | unknown | HD,SSCP | 222 | |||||
| 18 | TSC2-190 | deletion | 2042-2060delCAGGCCCCGCCGTGCGGCT | 675A-FS-X early at 691 | frameshift | mutation | 20 | unknown | HD,SSCP | 90 | |||||
| 18 | TSC2-191 | point | 2049C>T | 677P | silent | polymorphism | 20 | unknown | HD,SSCP | group | unique | ||||
| 18 | TSC2-62 | insertion | 2077-2080insTACT | 687S-FS-X early at 703 | frameshift | mutation | 15 | familial | unknown | 3 affected children from a sibship of 9, maternal germline mosaic | |||||
| 18 | TSC2-107 | deletion | 2088delC | 690F-FS-X early at 697 | frameshift | mutation | 23 | unknown | SSCP | TS94-104 | |||||
| 18 | TSC2-192 | deletion | 2092delG | 692V-FS-X early at 697 | frameshift | mutation | 0 | unknown | HD,SSCP | 81 | |||||
| 18 | TSC2-193 | point | 2105G>A | 696C>Y | missense | mutation | 20 | unknown | HD,SSCP | 253 | |||||
| intron 18 | TSC2-194 | point | 2115+35G>A | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | unique | |||||
| 19 | TSC2-195 | point | 2127G>A | 703W>X | nonsense | mutation | 20 | unknown | HD,SSCP | 310 | |||||
| 19 | TSC2-196 | deletion | 2160-2175delTGAGTCCCTGCGCTAT | 714P-FS-X early at 765 | frameshift | mutation | 20 | unknown | HD,SSCP | 86 | |||||
| 20 | TSC2-197 | point | 2269C>T | 751R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 6 | |||||
| 20 | TSC2-198 | point | 2269C>T | 751R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 54 | |||||
| 20 | TSC2-199 | point | 2269C>T | 751R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 245 | |||||
| 20 | TSC2-200 | insertion | 2313-2314insCC | 765A-FS-X early at 771 | frameshift | mutation | 20 | unknown | HD,SSCP | 238 | |||||
| intron 20 | TSC2-201 | point | 2373+2T>C | splicing | mutation | 20 | unknown | HD,SSCP | 142 | ||||||
| intron 20 | TSC2-202 | deletion | 2373+2-2373+5delTAGG | deletion through splice | mutation | 20 | unknown | HD,SSCP | 134 | ||||||
| intron 20 | TSC2-203 | point | 2374-2A>C | splicing | mutation | 25 | familial | ASO,SSCP | T5477 | ||||||
| 21 | TSC2-204 | point | 2388C>G | 790Y>X | nonsense | mutation | 20 | unknown | HD,SSCP | 158 | |||||
| 21 | TSC2-86 | point | 2465C>T | 816P>L | missense | unknown | 21 | sporadic | SSCP | 1125S | A different missense (Arg1329His) also seen in exon 32 of this same patient | ||||
| 21 | TSC2-132 | point | 2494C>A | 826L>M | missense | mutation | 24 | sporadic | SSCP | S19-01 | reported as 825L>M (off by one) | ||||
| 21 | TSC2-108 | insertion | 2508-2509insAT | 830L-FS-X early at 894 | frameshift | mutation | 23 | unknown | SSCP | TS94-82 | stop reported as 948, should be 894 | ||||
| 21 | TSC2-205 | deletion | 2548delC | 844L-FS-X early at 893 | frameshift | mutation | 20 | unknown | HD,SSCP | 235 | |||||
| 22 | TSC2-54 | point | 2598T>C | 860F | silent | polymorphism | 14 | unknown | SSCP | group | 1/60 chroms | ||||
| 22 | TSC2-133 | point | 2608C>T | 864Q>X | nonsense | mutation | 24 | sporadic | SSCP | S04-01 | |||||
| 22 | TSC2-55 | point | 2637G>T | 873L | silent | polymorphism | 14 | unknown | SSCP | group | 1/60 chroms | ||||
| 22 | TSC2-72 | deletion | 2656-2657+1delAAG | deletion through splice site | mutation | 19 | familial | SSCP | HOU-33 | Nomenclature makes it difficult to determine if this is correct or not, listed as 2638delA Ag+, K880FS-X909 | |||||
| intron 22 | TSC2-206 | point | 2657+44C>G | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | <5% | |||||
| 23 | TSC2-109 | point | 2679T>A | 887C>X | nonsense | mutation | 23 | unknown | SSCP | TS94-86 | |||||
| 23 | TSC2-43 | point | 2715G>T | 899R>S | missense | mutation | 10 | familial | linked | chr16 | PTT | 7 | cryptic splice site created, exon 25 truncated by 23bp | ||
| 23 | TSC2-110 | point | 2731C>T | 905R>W | missense | mutation | 23 | unknown | SSCP | TS95-12 | |||||
| 23 | TSC2-207 | point | 2731C>T | 905R>W | missense | mutation | 20 | sporadic | HD,SSCP | 362 | possible germline mosaic | ||||
| 23 | TSC2-134 | point | 2732G>A | 905R>Q | missense | mutation | 24 | familial | SSCP | F08-01 | |||||
| 24 | TSC2-111 | insertion | 2797insC | 927T-FS-X early at 939 | frameshift | mutation | 23 | familial | SSCP | HOU-23 | reported off by one as 928ProFS->939X | ||||
| c | 24 | TSC2-111 | insertion | 2797insC | 927T-FS-X early at 939 | frameshift | mutation | 19 | familial | ASO,SSCP | HOU-23 | female germline mosaicism | |||
| 24 | TSC2-135 | deletion | 2802delC | 928P-FS-X early at 947 | frameshift | mutation | 24 | familial | SSCP | F14-01 | reported as Phe927fs->947X, off by one | ||||
| 24 | TSC2-136 | deletion | 2832-2833delTA | 938T-FS-X early at 958 | frameshift | mutation | 24 | familial | SSCP | F04-01 | reported as Thr938fs->959X, off by one | ||||
| intron 24 | TSC2-208 | point | 2855+1G>T | splicing | mutation | 20 | unknown | HD,SSCP | 317 | ||||||
| 26 | TSC2-137 | point | 2992C>T | 992Q>X | nonsense | mutation | 24 | sporadic | SSCP | S17-01 | |||||
| 26 | TSC2-87 | point | 3036C>T | 1006N | silent | polymorphism | 21 | unknown | unknown | ||||||
| 26 | TSC2-88 | insertion | 3133-3136insTCCA | 1039T-FS-X early at 1168 | frameshift | mutation | 21 | sporadic | SSCP | 1704S | |||||
| 27 | TSC2-112 | point | 3270C>G | 1084D>E | missense | mutation | 23 | unknown | SSCP | TS87-117 | |||||
| 27 | TSC2-138 | point | 3283C>T | 1089Q>X | nonsense | mutation | 24 | sporadic | SSCP | S01-01 | |||||
| 28 | TSC2-209 | deletion | 3414delG | 1132S-FS-X early at 1190 | frameshift | mutation | 20 | unknown | HD,SSCP | 197 | |||||
| 29 | TSC2-89 | point | 3448G>T | 1144V>L | missense | unknown | 21 | familial | SSCP | 431F | patient has another missense mutation in exon 42 His1773Pro | ||||
| 29 | TSC2-210 | point | 3460C>T | 1148Q>X | nonsense | mutation | 20 | unknown | HD,SSCP | 119 | |||||
| 29 | TSC2-211 | point | 3592C>T | 1192Q>X | nonsense | mutation | 20 | unknown | HD,SSCP | 166 | |||||
| 29 | TSC2-212 | point | 3592C>T | 1192Q>X | nonsense | mutation | 20 | unknown | HD,SSCP | 233 | |||||
| 29 | TSC2-56 | point | 3616C>T | 1200R>W | missense | mutation | 14 | familial | linked | chr16 | SSCP | TSC-001 | Published as Arg1199Trp (off by one) | ||
| 29 | TSC2-113 | point | 3616C>T | 1200R>W | missense | mutation | 23 | unknown | SSCP | HOU11 | |||||
| 30 | TSC2-114 | insertion | 3629-1insGGAACACCAGCTGGCTG | 1204G-FS-X early at 1215 | frameshift | mutation | 23 | unknown | SSCP | TS93-41 | 17bp tandem duplication , no repeat sequences flanking the duplication were observed | ||||
| 30 | TSC2-66 | deletion | 3671-3678delCTTTCTCC | 1218P-FS-X early at 1230 | frameshift | mutation | 17 | sporadic | SSCP | T1206 | |||||
| 30 | TSC2-67 | point | 3680C>A | 1221S>X | nonsense | mutation | 17 | sporadic | SSCP | unknown | |||||
| 30 | TSC2-213 | insertion | 3691-3695insNNNNN | 1225N-FS-X in 3'UTR | frameshift | mutation | 20 | unknown | HD,SSCP | 15 | |||||
| 30 | TSC2-214 | deletion | 3713delC | 1232S-FS-X early at 1324 | frameshift | mutation | 20 | unknown | HD,SSCP | 377 | |||||
| intron 31 | TSC2-215 | point | 3901+78G>A | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | 5-10% | |||||
| intron 31 | TSC2-216 | point | 3902-55A>T | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | unique | |||||
| intron 31 | TSC2-217 | point | 3902-51C>G | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | ||||||
| 32 | TSC2-90 | point | 3931C>T | 1305P>S | missense | unknown | 21 | familial | SSCP | 1085F | reported as 3862C>T, Pro1292Ser (without exon 31b), in it's own numbering should be P1282S | ||||
| 32 | TSC2-91 | point | 3933G>A | 1305P | silent | polymorphism | 21 | unknown | unknown | reported without exon 31b as 3864G>A, Pro1282 | |||||
| 32 | TSC2-115 | point | 3974A>T | 1319D>V | missense | mutation | 23 | unknown | SSCP | TS93-44 | reported without exon 31b | ||||
| 32 | TSC2-92 | point | 4004G>A | 1329R>H | missense | unknown | 21 | sporadic | SSCP | 1125S | same patient also has missense variation 2465C>T, Pro816Leu exon 32, note reported without exon31b, as 3935G>A; R1306H | ||||
| 33 | TSC2-73 | point | 4273C>T | 1419Q>X | nonsense | mutation | 19 | familial | HOU-28 | germ-line mosaicism, repoted wihtout exon 31b as 33b C4186T Q1396X | |||||
| 33 | TSC2-218 | point | 4273C>T | 1419Q>X | nonsense | mutation | 20 | unknown | HD,SSCP | 186 | |||||
| 33 | TSC2-219 | point | 4316C>A | 1433S>X | nonsense | mutation | 20 | unknown | HD,SSCP | 1 | |||||
| 33 | TSC2-220 | point | 4326C>T | 1436D | silent | polymorphism | 20 | unknown | HD,SSCP | group | unique | ||||
| 33 | TSC2-221 | point | 4393C>T | 1459R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 27 | |||||
| 33 | TSC2-222 | point | 4393C>T | 1459R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 40 | |||||
| 33 | TSC2-223 | point | 4393C>T | 1459R>X | nonsense | mutation | 20 | unknown | HD,SSCP | 240 | |||||
| 33 | TSC2-224 | point | 4508C>G | 1497P>R | missense | mutation | 20 | sporadic | HD,SSCP | 220 | |||||
| 33 | TSC2-225 | point | 4511G>A | 1498S>N | missense | mutation | 20 | sporadic | HD,SSCP | 211 | |||||
| 34 | TSC2-16 | insertion | 4512insC | 1498S-FS-X early at 1523 | frameshift | mutation | 8 | sporadic | SSCP | 373 | |||||
| c | 34 | TSC2-16 | insertion | 4512insC | 1498S-FS-X early at 1523 | frameshift | mutation | 20 | sporadic | HD,SSCP | 373 | ||||
| 34 | TSC2-226 | deletion | 4542-4544delCTT | 1509delF | in-frame deletion | polymorphism | 26 | unknown | group | maybe should be shifted over one to agree with other polymorhpism reports? | |||||
| 34 | TSC2-57 | deletion | 4543-4545delTTC | 1509delF | in-frame deletion | polymorphism | originally reported as mutation, found by Maheshwar et al 1997 as polymorphism | 14 | sporadic | SSCP | TSC-077 | published without exon 31b as 4474 to 4476 | |||
| 34 | TSC2-17 | deletion | 4543-4545delTTC | 1509delF | in-frame deletion | polymorphism | 8 | unknown | SSCP | group | 2/173; also seen in 5 unaffected members of a TSC family | ||||
| 34 | TSC2-139 | deletion | 4543-4545delTTC | 1509delF | in-frame deletion | polymorphism | 24 | unknown | SSCP | unknown | 0.025 | ||||
| 34 | TSC2-18 | point | 4554C>T | 1512D | silent | polymorphism | 8 | unknown | SSCP | group | 1/173 | ||||
| 34 | TSC2-140 | point | 4554C>T | 1512D | silent | polymorphism | 24 | unknown | SSCP | unknown | freq 0.013 | ||||
| 34 | TSC2-227 | point | 4554C>T | 1512D | silent | polymorphism | 26 | unknown | group | ||||||
| 34 | TSC2-19 | deletion | 4559-4562delCAAA | 1514S-FS-X early at 1574 | frameshift | mutation | 8 | unknown | SSCP | 147 | |||||
| c | 34 | TSC2-19 | deletion | 4559-4562delCAAA | 1514S-FS-X early at 1574 | frameshift | mutation | 20 | unknown | HD,SSCP | 147 | ||||
| 34 | TSC2-116 | deletion | 4562-4565delACAA | 1515N-FS-X early at 1574 | frameshift | mutation | 23 | unknown | SSCP | TS93-20 | reported without exon 31b | ||||
| 35 | TSC2-58 | insertion | 4588-1insTCACAGTCCTTTGAGCGGTCGGTGCAGCT | 1524S-FS-X early at 1585 | frameshift | mutation | 14 | unknown | SSCP | TSC-422 | 29bp tandem duplication, reported without exon31b as 4519-4547 | ||||
| 35 | TSC2-20 | deletion | 4594-4600delTCCTTTG | 1526S-FS-X early at 1573 | frameshift | mutation | 8 | unknown | SSCP | 234 | |||||
| c | 35 | TSC2-20 | deletion | 4594-4600delTCCTTTG | 1526S-FS-X early at 1573 | frameshift | mutation | 20 | unknown | HD,SSCP | 234 | ||||
| 35 | TSC2-21 | deletion | 4609delG | 1531V-FS-X early at 1575 | frameshift | mutation | 8 | sporadic | SSCP | 93 | |||||
| c | 35 | TSC2-21 | deletion | 4609delG | 1531V-FS-X early at 1575 | frameshift | mutation | 20 | sporadic | HD,SSCP | 93 | ||||
| 35 | TSC2-11 | deletion | 4659delC | 1547V-FS-X early at 1575 | frameshift | mutation | 5 | familial | linked | chr16 LOD1.61 | 427 | reported without exon 31b | |||
| c | 35 | TSC2-11 | deletion | 4659delC | 1547V-FS-X early at 1575 | frameshift | mutation | 21 | familial | PTT,SSCP | 427F | could be this C or the C to the right | |||
| 35 | TSC2-117 | point | 4664A>G | 1549Y>C | missense | mutation | 23 | unknown | SSCP | TS92-08 | reported without exon 31b | ||||
| intron 35 | TSC2-22 | point | 4680+17G>A | non-coding | polymorphism | 8 | unknown | SSCP | group | 1/173 | |||||
| intron 35 | TSC2-23 | point | 4680+18G>A | non-coding | polymorphism | 8 | unknown | SSCP | group | 1/173 | |||||
| intron 35 | TSC2-24 | point | 4680+41G>C | non-coding | polymorphism | 8 | unknown | SSCP | group | 1/173 | |||||
| intron 35 | TSC2-228 | point | 4681-43G>A | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | unique | |||||
| 36 | TSC2-44 | deletion | 4681-4682delAG | 1555S-FS-X early at 1564 | frameshift | mutation | 10 | sporadic | PTT | 6 | |||||
| 36 | TSC2-25 | point | 4707C>T | 1563S | silent | polymorphism | 8 | unknown | SSCP | group | 1/173 | ||||
| 36 | TSC2-26 | point | 4731C>G | 1571Y>X | nonsense | mutation | 8 | unknown | SSCP | 230 | |||||
| c | 36 | TSC2-26 | point | 4731C>G | 1571Y>X | nonsense | mutation | 20 | unknown | HD,SSCP | 230 | ||||
| 36 | TSC2-27 | point | 4798C>A | 1594L>M | missense | mutation | 8 | sporadic | SSCP | 306 | |||||
| c | 36 | TSC2-27 | point | 4798C>A | 1594L>M | missense | mutation | 20 | sporadic | HD,SSCP | 306 | ||||
| 36 | TSC2-118 | deletion | 4857-4859delCAT | 1614delI | in-frame deletion | mutation | 23 | unknown | SSCP | TS93-14 | reported without exon 31b | ||||
| 37 | TSC2-28 | point | 4929G>A | 1637K | silent | polymorphism | 8 | unknown | SSCP | group | 1/173 | ||||
| 37 | TSC2-229 | point | 4929G>A | 1637K | silent | polymorphism | 26 | unknown | group | unique | |||||
| 37 | TSC2-119 | point | 4946A>T | 1643N>I | missense | mutation | 23 | unknown | SSCP | TS94-53 | reported without exon 31b | ||||
| 37 | TSC2-29 | point | 4947C>G | 1643N>K | missense | mutation | 8 | sporadic | SSCP | 367 | creates EcoNI site | ||||
| c | 37 | TSC2-29 | point | 4947C>G | 1643N>K | missense | mutation | 20 | sporadic | HD,SSCP | 367 | ||||
| 37 | TSC2-69 | deletion | 4951-4952delTT | 1645F-FS-X early at 1651 | frameshift | mutation | 18 | familial | SSCP | T5207 | published without exon 31b as 4882delTT | ||||
| 37 | TSC2-68 | deletion | 4951-4952delTT | 1645F-FS-X early at 1651 | frameshift | mutation | 18 | sporadic | SSCP | T1327 | published without exon 31b as 4882delTT | ||||
| 37 | TSC2-141 | point | 4967A>G | 1650Y>C | missense | mutation | 24 | sporadic | SSCP | S16-01 | |||||
| 37 | TSC2-30 | point | 4970A>G | 1651N>S | missense | mutation | 8 | sporadic | SSCP | 276 | sporadic in proband, passed to 2 affected sons | ||||
| c | 37 | TSC2-30 | point | 4970A>G | 1651N>S | missense | mutation | 20 | sporadic | HD,SSCP | 276 | ||||
| 37 | TSC2-93 | point | 4977C>T | 1653S | silent | polymorphism | 21 | unknown | unknown | published without exon 31b | |||||
| 37 | TSC2-31 | point | 4977C>T | 1653S | silent | polymorphism | 8 | unknown | SSCP | group | 4/173 | ||||
| 37 | TSC2-142 | point | 4977C>T | 1653S | silent | polymorphism | 24 | unknown | SSCP | unknown | freq 0.013 | ||||
| 37 | TSC2-230 | point | 4977C>T | 1653S | silent | polymorphism | 26 | unknown | group | <5% | |||||
| 37 | TSC2-94 | point | 5001C>T | 1661T | silent | polymorphism | 21 | unknown | unknown | ||||||
| intron 37 | TSC2-45 | insertion | 5007+2insA | insertion in conserved splice region | mutation | 10 | sporadic | PTT | 1 | uses cryptic splice site in normal sequence, exon 37 truncated by 29 bp | |||||
| 38 | TSC2-32 | point | 5011C>T | 1665Q>X | nonsense | mutation | 8 | sporadic | SSCP | 36 | also had mutation at 4947 | ||||
| c | 38 | TSC2-32 | point | 5011C>T | 1665Q>X | nonsense | mutation | 20 | sporadic | HD,SSCP | 36 | ||||
| 38 | TSC2-36 | point | 5042C>T | 1675P>L | missense | mutation | 8 | sporadic | SSCP | 302 | Abolishes a AciI site | ||||
| c | 38 | TSC2-36 | point | 5042C>T | 1675P>L | missense | mutation | 20 | sporadic | HD,SSCP | 302 | ||||
| 38 | TSC2-35 | point | 5042C>T | 1675P>L | missense | mutation | 8 | unknown | SSCP | 247 | Abolishes a AciI site; segregates with affecteds and not present in 124 control chromosomes | ||||
| c | 38 | TSC2-35 | point | 5042C>T | 1675P>L | missense | mutation | 20 | unknown | HD,SSCP | 247 | ||||
| 38 | TSC2-34 | point | 5042C>T | 1675P>L | missense | mutation | 8 | unknown | SSCP | 84 | Abolishes a AciI site | ||||
| c | 38 | TSC2-34 | point | 5042C>T | 1675P>L | missense | mutation | 20 | unknown | HD,SSCP | 84 | ||||
| 38 | TSC2-33 | point | 5042C>T | 1675P>L | missense | mutation | 8 | unknown | SSCP | 241 | Abolishes a AciI site | ||||
| c | 38 | TSC2-33 | point | 5042C>T | 1675P>L | missense | mutation | 20 | unknown | HD,SSCP | 241 | ||||
| 38 | TSC2-143 | deletion | 5043delG | 1675P-FS-X in 3'UTR | frameshift | mutation | 24 | familial | SSCP | F10-01 | |||||
| 38 | TSC2-37 | point | 5061C>G | 1681N>K | missense | mutation | 8 | sporadic | SSCP | 223 | |||||
| c | 38 | TSC2-37 | point | 5061C>G | 1681N>K | missense | mutation | 20 | sporadic | HD,SSCP | 223 | ||||
| 38 | TSC2-144 | deletion | 5069-5086+16delCCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG | deletion through splice site | mutation | 24 | familial | SSCP | S12 | originally thought to be sporadic family, but same deletion found in father, results in insertion of 24 novel amino acids in RNA due to splicing defect | |||||
| 38 | TSC2-243 | deletion | 5069-5086+16delCCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG | deletion through splice site | mutation | 20 | unknown | HD,SSCP | 112 | ||||||
| 38 | TSC2-145 | point | 5086G>T | 1690D>Y | missense | mutation | 24 | familial | SSCP | F19-01 | |||||
| intron 38 | TSC2-6 | point | 5087-2A>G | splicing | mutation | 4 | sporadic | unknown | |||||||
| c | intron 38 | TSC2-6 | point | 5087-2A>G | splicing | mutation | 20 | sporadic | HD,SSCP | 248 | |||||
| 39 | TSC2-146 | deletion | 5096-5099delGCCT | 1693G-FS-X in 3'UTR | frameshift | mutation | 24 | sporadic | SSCP | S14-01 | |||||
| 39 | TSC2-95 | point | 5144C>T | 1709P>L | missense | unknown | 21 | sporadic | SSCP | 1671S | reported wihtout exon 31b as 5075C>T | ||||
| 39 | TSC2-59 | point | 5144C>T | 1709P>L | missense | mutation | 14 | sporadic | SSCP | unknown | published without exon 31b as 5075C>T, Pro1186 Leu, seems to be a misprint and should be P1686L | ||||
| 39 | TSC2-60 | point | 5153C>A | 1712A>D | missense | mutation | 14 | unknown | SSCP | TSC-115 | |||||
| intron 39 | TSC2-7 | deletion | 5178-5178+1delTG | deletion through splice site | mutation | 4 | sporadic | unknown | |||||||
| c | intron 39 | TSC2-7 | deletion | 5178-5178+1delTG | deletion through splice site | mutation | 20 | sporadic | HD,SSCP | 351 | |||||
| intron 39 | TSC2-14 | deletion | 5179-10-5179-7delACGT | deletion in non-coding | unknown | 7 | sporadic | SSCP | 1799 | sequencing parents did not show same deletion, same patient also has a frameshift mutation at 5179 | |||||
| intron 39 | TSC2-231 | point | 5179-9C>A | non-coding | polymorphism | 20 | unknown | HD,SSCP | group | 5-10%, reported transposed as A5179-9C (or in old intron sequence!) | |||||
| 40 | TSC2-15 | deletion | 5179delA | 1721M-FS-X in 3'UTR | frameshift | mutation | 7 | sporadic | 1799 | originally reported as 5110delA (exon 31b not included) | |||||
| c | 40 | TSC2-15 | deletion | 5179delA | 1721M-FS-X in 3'UTR | frameshift | mutation | 21 | sporadic | SSCP | 1799S | published without exon31b | |||
| 40 | TSC2-147 | point | 5188C>T | 1724Q>X | nonsense | mutation | 24 | sporadic | SSCP | S09-01 | |||||
| 40 | TSC2-46 | point | 5220T>C | 1734D | silent | polymorphism | 11 | unknown | group | EcoRV, 23/71 heterozygous, originally reported as T5151C | |||||
| 40 | TSC2-148 | point | 5220T>C | 1734D | silent | polymorphism | 24 | unknown | SSCP | unknown | 0.163 | ||||
| 40 | TSC2-1 | point | 5220T>C | 1734D | silent | polymorphism | 1 | unknown | group | 0.33 | |||||
| 40 | TSC2-232 | point | 5220T>C | 1734D | silent | polymorphism | 26 | unknown | group | >10% | |||||
| 40 | TSC2-233 | deletion | 5229-5232delCTCC | 1737P-FS-X in 3'UTR | frameshift | mutation | 20 | unknown | HD,SSCP | 229 | |||||
| 40 | TSC2-96 | point | 5246G>A | 1743R>Q | missense | unknown | 21 | sporadic | SSCP | 1749S | published wihtout exon 31b as 5177G>A | ||||
| 40 | TSC2-234 | point | 5246G>C | 1743R>P | missense | mutation | 20 | unknown | HD,SSCP | 50 | |||||
| 40 | TSC2-149 | deletion | 5256-5273delCATCAAGCGGCTCCGCCA | 1746delHIKRLR | in-frame deletion | mutation | 24 | sporadic | SSCP | S18-01 | |||||
| 40 | TSC2-235 | deletion | 5256-5273delCATCAAGCGGCTCCGCCA | 1746delHIKRLR | in-frame deletion | mutation | 20 | unknown | HD,SSCP | 311 | |||||
| 40 | TSC2-236 | deletion | 5256-5273delCATCAAGCGGCTCCGCCA | 1746delHIKRLR | in-frame deletion | mutation | 20 | unknown | HD,SSCP | 3 | |||||
| 40 | TSC2-237 | deletion | 5256-5273delCATCAAGCGGCTCCGCCA | 1746delHIKRLR | in-frame deletion | mutation | 20 | sporadic | HD,SSCP | 44 | |||||
| 40 | TSC2-238 | deletion | 5256-5273delCATCAAGCGGCTCCGCCA | 1746delHIKRLR | in-frame deletion | mutation | 20 | unknown | HD,SSCP | 360 | |||||
| 40 | TSC2-120 | point | 5266C>T | 1750L>F | missense | mutation | 23 | unknown | SSCP | TS91-03 | reported without exon 31b | ||||
| intron 40 | TSC2-150 | point | 5277+72C>T | non-coding | polymorphism | 24 | unknown | SSCP | unknown | ||||||
| 41 | TSC2-97 | point | 5336A>C | 1773H>P | missense | unknown | 21 | familial | SSCP | 431F | patient also has missense V144M in exon 29, reported wihtout exon 31b as 5267A>C His1750Pro | ||||
| 41 | TSC2-8 | deletion | 5358-5389delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG | 1780T-FS-X in 3'UTR | frameshift | mutation | 4 | unknown | ASO | unknown | |||||
| c | 41 | TSC2-8 | deletion | 5358-5389delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG | 1780T-FS-X in 3'UTR | frameshift | mutation | 20 | unknown | HD,SSCP | 18 | ||||
| 41 | TSC2-98 | point | 5383G>C | 1789E>Q | missense | unknown | 21 | familial | SSCP | 437F | reported as 5314G>C Glu1760Gln, this means that it could be here, and the nucleotides are right or be at nuc 5365 (with exon 31b) and the amino acid is correct. Original report listed without exon31b | ||||
| 41 | TSC2-239 | point | 5389G>A | 1791G>S | missense | polymorphism | 20 | unknown | HD,SSCP | group | |||||
| 41 | TSC2-9 | insertion | 5406insC | 1796L-FS-X in 3'UTR | frameshift | mutation | 4 | unknown | ASO | unkown | |||||
| c | 41 | TSC2-9 | insertion | 5406insC | 1796L-FS-X in 3'UTR | frameshift | mutation | 20 | unknown | HD,SSCP | 357 | ||||
| 41 | TSC2-61 | point | 5415G>C | 1799S | silent | polymorphism | 14 | unknown | SSCP | group | 1/60 chroms, published without exon 31b | ||||
| 41 | TSC2-2 | point | 5415G>C | 1799S | silent | polymorphism | 1 | unknown | group | 0.18 | |||||
| 41 | TSC2-240 | point | 5415G>C | 1799S | silent | polymorphism | 26 | unknown | group | >10% | |||||
| 41 | TSC2-10 | insertion | 5425insT | 1803F-FS-X in 3'UTR | frameshift | mutation | 4 | unknown | ASO | unknown | |||||
| c | 41 | TSC2-10 | insertion | 5425insT | 1803F-FS-X in 3'UTR | frameshift | mutation | 20 | unknown | HD,SSCP | 172 | ||||
| 3'UTR | TSC2-241 | point | 5442+26G>A | non-coding | polymorphism | 21 | unknown | unknown | 3' UTR | ||||||
| 3'UTR | TSC2-12 | deletion | 5442+55-5442+58delTAAA | deletion in non-coding | polymorphism | 5 | familial | linked | chr16 LOD1.61 | SSCP | 427 | another mutation occurs in the same family at 4659, this is in the two partially overlapping polyadenylation signals of the 3'UTR; detected in 2 control families | |||
| 3'UTR | TSC2-242 | deletion | 5442+61-5442+62delAA | deletion in non-coding | polymorphism | 20 | unknown | HD,SSCP | group | <5% |