Tuberous Sclerosis Project    

Home | TSC1 references

TSC1 Variations +1 ATG, 8/8/99

indep conf exon official id type nuc change aa change effect mut/poly status method used to determined mut/poly status reference index inheritance   region linked to detection method patient id comments
  intron3 TSC1-78 point 107-2A>G   splicing mutation   5 familial     HD,SSCP CL3  
  4 TSC1-8 deletion 145delT 49Y-FS-X early at 61 frameshift mutation   2 familial     SSCP T2545 Published as 367delT, Ts present at 365,366 and 370 but not 367
  4 TSC1-37 point 153A>C 51E>D missense unknown   2 unknown     SSCP T5768  
  intron4 TSC1-3 point 210+33G>A   non-coding polymorphism   1 unknown     2D-DGGE group seen in 3/63 patients, het 0.048, published as 431+32G>A
  intron4 TSC1-9 point 211-1G>A   splicing mutation   2 sporadic     SSCP T1817 parents tested negative for the mutation
  5 TSC1-79 point 272C>A 91S>X nonsense mutation   5 familial     HD,SSCP 327  
  5 TSC1-10 point 308G>A 103W>X nonsense mutation   2 familial     SSCP T1214  
c 5 TSC1-10 point 308G>A 103W>X nonsense mutation   1 familial     2D-DGGE T1214 Found in blinded analysis
  5 TSC1-80 point 309G>A 103W>X nonsense mutation   5 sporadic     HD,SSCP 280  
  5 TSC1-46 insertion 334-335insTC 112L-FS-X early at 118 frameshift mutation   4 unknown     HD,SSCP 5528 Listed as a 'problem' linked family
  intron5 TSC1-111 point 364-1G>C   splicing mutation   6 sporadic     HD,SSCP unknown  
c intron5 TSC1-111 point 364-1G>C   splicing mutation   1 sporadic     2D-DGGE unknown  
  6 TSC1-47 insertion 372insT 124T-FS-X early at 125 frameshift mutation   4 familial linked chr9 HD,SSCP 5525  
  7 TSC1-81 deletion 526-527delTA 176Y-FS-X early at 216 frameshift mutation   5 familial     HD,SSCP 215  
  7 TSC1-127 point 532G>A 178V>I missense polymorphism   6 unknown     HD,SSCP group 0%het (100 controls)
c 7 TSC1-127 point 532G>A 178V>I missense polymorphism   1 unknown     2D-DGGE unknown Found in blinded analysis
  7 TSC1-155 point 555C>T 185Y silent polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.003
c 7 TSC1-155 point 555C>T 185Y silent polymorphism   1 unknown     2D-DGGE 1  
  7 TSC1-38 point 568C>T 190R>C missense polymorphism polymorhpism status from Jones et al. 2 unknown     SSCP T1486 Published aa change is 190R>S but actual change is 190R>C
  7 TSC1-39 point 572T>A 191L>H missense unknown   2 unknown     SSCP T4712  
  7 TSC1-11 deletion 593-595delACT [198N>I;199delF] in-frame deletion mutation   2 familial     SSCP T1298  
  7 TSC1-134 deletion 647-648delTT 216F>X frameshift mutation   8 sporadic     HD unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 7 TSC1-134 deletion 647-648delTT 216F>X frameshift mutation   1 sporadic     2D-DGGE 5  
  7 TSC1-48 insertion 654insA 218E-FS-X early at 241 frameshift mutation   4 unknown     HD,SSCP 5575 small family
  7 TSC1-112 insertion 654insA 218E-FS-X early at 241 frameshift mutation   6 familial     HD,SSCP unknown  
  8 TSC1-40 point 671T>G 224M>R missense unknown   2 unknown     SSCP T1524  
  8 TSC1-49 point 682C>T 228R>X nonsense mutation   4 unknown     HD,SSCP 5386 small family
  8 TSC1-133 point 682C>T 228R>X nonsense mutation   7 familial     SSCP HOU-21 germ-line mosaicism, reported as ATG+1, 682C>T
  8 TSC1-135 point 682C>T 228R>X nonsense mutation   8 familial     SSCP unknown  
c 8 TSC1-135 point 682C>T 228R>X nonsense mutation   1 familial     2D-DGGE 6  
  8 TSC1-12 insertion 723insA 241E-FS-X early at 254 frameshift mutation   2 familial     SSCP T4715  
c 8 TSC1-12 insertion 723insA 241E-FS-X early at 254 frameshift mutation   10 familial     ASO T4715 This reference lists the mutation as 942insA, but the original report has it as 944insA; mosaic
  8 TSC1-1 point 733C>T 245R>X nonsense mutation   1 unknown     2D-DGGE 7 not previously reported for this patient
  8 TSC1-13 deletion 737delG 246R-FS-X early at 250 frameshift mutation   2 sporadic     SSCP T8129  
  intron8 TSC1-100 point 737+3A>G   non-coding polymorphism   5 unknown     HD,SSCP unknown unique to this set of patients
  9 TSC1-156 point 738G>A 246R silent polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq <0.01, seen in one cDNA clone, not in 100 alleles
  9 TSC1-14 point 745A>T 249R>X nonsense mutation   2 sporadic     SSCP T7806  
c 9 TSC1-14 point 745A>T 249R>X nonsense mutation   1 sporadic     2D-DGGE T7806 (62 in paper) Found in blinded analysis
  9 TSC1-50 deletion 745delA 249R-FS-X early at 250 frameshift mutation   4 unknown     HD,SSCP 5302 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
  9 TSC1-51 point 749T>G 250L>X nonsense mutation   4 unknown     HD,SSCP 5214 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., listed as a 'problem' family wrt inheritance
c 9 TSC1-51 point 749T>G 250L>X nonsense mutation   1 unknown     2D-DGGE (46 in paper) Found in blinded analysis
  9 TSC1-52 point 772G>T 258E>X nonsense mutation   4 familial linked chr9 HD,SSCP 5348 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 9 TSC1-52 point 772G>T 258E>X nonsense mutation   1 familial     2D-DGGE (45 in paper) Found in blinded analysis
  9 TSC1-53 point 891T>G 297Y>X nonsense mutation   4 familial linked chr9 HD,SSCP 5477 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  9 TSC1-113 point 901C>T 301Q>X nonsense mutation   6 familial linked TSC1 linkage or LOH HD,SSCP unknown  
c 9 TSC1-113 point 901C>T 301Q>X nonsense mutation   1 familial     2D-DGGE unknown Found in blinded analysis
  9 TSC1-136 deletion 901-913+1delCAGAATAGCTATGG   deletion through splice site mutation   8 sporadic     HD,SSCP unknown  
c 9 TSC1-136 deletion 901-913+1delCAGAATAGCTATGG   deletion through splice site mutation   1 sporadic     2D-DGGE 9  
  intron9 TSC1-73 point 914-18T>C   non-coding polymorphism   4 unknown     HD,SSCP 5301  
  10 TSC1-16 point 936C>A 312Y>X nonsense mutation   2 sporadic     SSCP T9809  
  10 TSC1-4 point 965T>C 322M>T missense polymorphism   1 unknown     2D-DGGE group seen in 7/63 patients, het 0.111
  10 TSC1-74 point 965T>C 322M>T missense polymorphism   4 unknown     HD,SSCP group Approx. allele frequency 15%
  10 TSC1-101 point 965T>C 322M>T missense polymorphism   5 unknown     HD,SSCP group rare allele frequency of 15%
  10 TSC1-128 point 965T>C 322M>T missense polymorphism   6 unknown     HD,SSCP group 30% het (20 controls), present in 8% of patients
  10 TSC1-157 point 965T>C 322M>T missense polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.076
  10 TSC1-137 deletion 988-989delCT 330L-FS-X early at 339 frameshift mutation   8 sporadic     HD unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 10 TSC1-137 deletion 988-989delCT 330L-FS-X early at 339 frameshift mutation   1 sporadic     2D-DGGE 10  
  10 TSC1-17 insertion 989insT 330L-FS-X early at 340 frameshift mutation   2 familial     SSCP T1207  
  10 TSC1-82 point 1001C>A 334S>X nonsense mutation   5 sporadic     HD,SSCP 256  
c 10 TSC1-82 point 1001C>A 334S>X nonsense mutation   1 sporadic     2D-DGGE 256 (33 in paper)  
  10 TSC1-15 deletion 1019delA 340E-FS-X early at 355 frameshift mutation   2 familial     SSCP T3945  
  intron10 TSC1-114 point 1029+1G>A   splicing mutation   6 familial linked TSC1 linkage or LOH HD,SSCP unknown  
  intron10 TSC1-83 point 1029+1G>A   splicing mutation   5 familial     HD,SSCP CL1  
c intron10 TSC1-83 point 1029+1G>A   splicing mutation   1 familial     2D-DGGE CLI (28 in paper)  
  intron10 TSC1-102 point 1030-9A>G   non-coding polymorphism   5 unknown     HD,SSCP unknown unique to this set of patients
c intron10 TSC1-102 point 1030-9A>G   non-coding polymorphism   1 unknown     2D-DGGE 191  
  11 TSC1-84 insertion 1110insA 370S-FS-X early at 375 frameshift mutation   5 sporadic     HD,SSCP 322  
c 11 TSC1-84 insertion 1110insA 370S-FS-X early at 375 frameshift mutation   1 sporadic     2D-DGGE 322  
  12 TSC1-115 deletion 1203delT 401C-FS-X early at 439 frameshift mutation   6 familial linked TSC1 linkage or LOH HD,SSCP unknown  
  12 TSC1-41 point 1208C>T 403S>L missense unknown   2 unknown     SSCP T10383 published as silent, but there is no other C in the codon, and the existing one does change it to an leucine
  12 TSC1-18 deletion 1252delC 418P-FS-X early at 439 frameshift mutation   2 familial     SSCP T10301  
c 12 TSC1-18 deletion 1252delC 418P-FS-X early at 439 frameshift mutation   10 familial     ASO T10301 mosaic
  13 TSC1-19 deletion 1278delT 426D-FS-X early at 439 frameshift mutation   2 familial linked chr9 SSCP T1515  
  13 TSC1-54 point 1331C>G 444S>X nonsense mutation   4 unknown     HD,SSCP 5515 small family
c 13 TSC1-54 point 1331C>G 444S>X nonsense mutation   1 unknown     2D-DGGE unknown Found in blinded analysis
  13 TSC1-116 point 1331C>G 444S>X nonsense mutation   6 familial linked TSC1 linkage or LOH HD,SSCP unknown  
  intron13 TSC1-103 point 1333+13C>T   non-coding polymorphism   5 unknown     HD,SSCP unknown unique to this set of patients
c intron13 TSC1-103 point 1333+13C>T   non-coding polymorphism   1 unknown     2D-DGGE unknown  
  intron13 TSC1-104 point 1334-55C>G   non-coding polymorphism   5 unknown     HD,SSCP unknown unique to this set of patients
  14 TSC1-5 point 1335A>G 445E silent polymorphism   1 unknown     2D-DGGE group seen in 4/63 patients, het 0.063
  14 TSC1-42 point 1335A>G 445E silent polymorphism   2 unknown     SSCP T2083  
  14 TSC1-75 point 1335A>G 445E silent polymorphism   4 unknown     HD,SSCP group Approx. allele frequency 8%
c 14 TSC1-75 point 1335A>G 445E silent polymorphism   1 unknown     2D-DGGE unknown Found in blinded analysis
  14 TSC1-105 point 1335A>G 445E silent polymorphism   5 unknown     HD,SSCP group rare allele frequency 14%
  14 TSC1-138 insertion 1433-1434insGA 478E-FS-X early at 532 frameshift mutation   8 familial     HD,SSCP unknown  
c 14 TSC1-138 insertion 1433-1434insGA 478E-FS-X early at 532 frameshift mutation   1 familial     2D-DGGE 11  
  15 TSC1-20 point 1498C>T 500R>X nonsense mutation   2 sporadic     SSCP T2965 This change also causes a change in TaqI fragments
c 15 TSC1-20 point 1498C>T 500R>X nonsense mutation   1 unknown     2D-DGGE T5113 (63 in paper) are patients the same? ids are different
  15 TSC1-21 point 1525C>T 509R>X nonsense mutation   2 sporadic     SSCP T9886  
  15 TSC1-85 point 1525C>T 509R>X nonsense mutation   5 sporadic     HD,SSCP 312 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-85 point 1525C>T 509R>X nonsense mutation   1 sporadic     2D-DGGE 312 Found in blinded analysis
  15 TSC1-117 point 1525C>T 509R>X nonsense mutation   6 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  15 TSC1-139 point 1525C>T 509R>X nonsense mutation   8 familial     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-139 point 1525C>T 509R>X nonsense mutation   1 familial     2D-DGGE 14  
  15 TSC1-140 point 1525C>T 509R>X nonsense mutation   8 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-140 point 1525C>T 509R>X nonsense mutation   1 sporadic     2D-DGGE 13  
  15 TSC1-55 deletion 1529-1530delAC 510D-FS-X early at 533 frameshift mutation   4 unknown     HD,SSCP 5235 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
  15 TSC1-86 deletion 1580-1581delAG 527Q-FS-X early at 533 frameshift mutation   5 familial     HD,SSCP 141 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-86 deletion 1580-1581delAG 527Q-FS-X early at 533 frameshift mutation   1 familial     2D-DGGE 141  
  15 TSC1-158 point 1669C>T 557L silent polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.003
c 15 TSC1-158 point 1669C>T 557L silent polymorphism   1 unknown     2D-DGGE 15 unique in this set of patients
  15 TSC1-22 deletion 1671-1693delGCCCTGCGGCAGTGCTGATGAAA 557L-FS-X early at 579 frameshift mutation   2 sporadic     SSCP T3922 parents tested negative for the mutation (del23bp)
  15 TSC1-165 insertion 1671-1693insGCCCTGCGGCAGTGCTGATGAAA 557L-FS-X early at 563 frameshift mutation   3 unknown       unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al; duplication of 23bp between two 9bp repeats of GCCCTGCGG at 1892 and 1915, found in an infant with cardiac rhabdomyomas
  15 TSC1-23 deletion 1708-1709delAG 570R-FS-X early at 586 frameshift mutation   2 familial     SSCP T2067 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  15 TSC1-141 deletion 1708-1709delAG 570R-FS-X early at 586 frameshift mutation   8 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-141 deletion 1708-1709delAG 570R-FS-X early at 586 frameshift mutation   1 sporadic     2D-DGGE 16  
  15 TSC1-118 point 1717C>T 573Q>X nonsense mutation   6 sporadic     HD,SSCP unknown  
c 15 TSC1-118 point 1717C>T 573Q>X nonsense mutation   1 sporadic     2D-DGGE unknown  
  15 TSC1-2 point 1729G>T 577E>X nonsense mutation   1 unknown     2D-DGGE 15 not previously reported for this patient, aa change reported as E587X should be E577X
  15 TSC1-24 deletion 1757-1765delGTAAAATTC [586C>S;587delKIP] in-frame deletion mutation   2 sporadic     SSCP T5913 parents tested negative for the mutation
  15 TSC1-159 point 1760A>G 587K>R missense polymorphism seen in one or more unaffected parents/controls 8 unknown       group Originally reported in Science (1997) 277:805-808, vanSlegtenhorst et al. as a missense, but found in an unaffected parent, charge & size conserved sub
  15 TSC1-119 insertion 1774-1775insGA 592T-FS-X early at 629 frameshift mutation   6 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., predicted TSC1 by LOH
  15 TSC1-25 deletion 1786delT 596F-FS-X early at 628 frameshift mutation   2 sporadic     SSCP T2636 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.; parents tested negative for the mutation
  15 TSC1-142 deletion 1823-1824delTT 608F>X frameshift mutation   8 familial     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., causes immediate stop codon
c 15 TSC1-142 deletion 1823-1824delTT 608F>X frameshift mutation   1 familial     2D-DGGE 17  
  15 TSC1-56 deletion 1839delA 613P-FS-X early at 628 frameshift mutation   4 sporadic     HD,SSCP 5278 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  15 TSC1-26 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   2 sporadic     SSCP T4124 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  15 TSC1-87 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   5 familial     HD,SSCP 176 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-87 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   1 familial     2D-DGGE 176 Found in blinded analysis
  15 TSC1-120 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   6 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.; in analysis of renal cell carcinoma found mutation 1957delG at the other allele
  15 TSC1-143 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   8 familial     HD unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-143 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   1 unknown     2D-DGGE 19  
  15 TSC1-144 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   8 unknown     HD unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
c 15 TSC1-144 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   1 unknown     2D-DGGE 18  
  15 TSC1-145 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   8 sporadic     HD unknown  
c 15 TSC1-145 deletion 1884-1887delAAAG 628L-FS-X early at 651 frameshift mutation   1 unknown     2D-DGGE 20  
  15 TSC1-88 deletion 1901-1902delAC 634N-FS-X early at 686 frameshift mutation   5 sporadic     HD,SSCP 250 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-88 deletion 1901-1902delAC 634N-FS-X early at 686 frameshift mutation   1 sporadic     2D-DGGE 250 missed in blinded study
  15 TSC1-146 deletion 1901-1902delAC 634N-FS-X early at 686 frameshift mutation   8 sporadic     HD unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  15 TSC1-147 deletion 1901-1902delAC 634N-FS-X early at 686 frameshift mutation   8 sporadic     HD unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-147 deletion 1901-1902delAC 634N-FS-X early at 686 frameshift mutation   1 unknown     2D-DGGE 3  
  15 TSC1-148 deletion 1905-1906delAG 635T-FS-X early at 686 frameshift mutation   8 familial     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-148 deletion 1905-1906delAG 635T-FS-X early at 686 frameshift mutation   1 familial     2D-DGGE 21  
  15 TSC1-149 deletion 1955-1956delTG 652L-FS-X early at 686 frameshift mutation   8 familial     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 15 TSC1-149 deletion 1955-1956delTG 652L-FS-X early at 686 frameshift mutation   1 familial     2D-DGGE 22  
  15 TSC1-150 point 1960C>T 654Q>X nonsense mutation   8 sporadic     SSCP unknown Published as Q554X should be Q654X
c 15 TSC1-150 point 1960C>T 654Q>X nonsense mutation   1 sporadic     2D-DGGE 23 Also listed incorrectly as Q554X
  16 TSC1-166 deletion 2030-2040delCCCACTTTGGA 677T-FS-X early at 683 frameshift mutation   9 sporadic       unknown  
  16 TSC1-76 point 2039G>A 680G>E missense polymorphism   4 unknown     HD,SSCP group Approx. allele frequency 0.6
c 16 TSC1-76 point 2039G>A 680G>E missense polymorphism   1 unknown     2D-DGGE unknown  
  17 TSC1-27 point 2074C>T 692R>X nonsense mutation   2 familial     SSCP T1197  
  17 TSC1-28 point 2074C>T 692R>X nonsense mutation   2 sporadic     SSCP T3838 parents tested negative for the mutation
  17 TSC1-29 point 2074C>T 692R>X nonsense mutation   2 sporadic     SSCP T3908  
  17 TSC1-30 point 2074C>T 692R>X nonsense mutation   2 sporadic     SSCP T5210 parents tested negative for the mutation
  17 TSC1-31 point 2074C>T 692R>X nonsense mutation   2 sporadic     SSCP T10816 parents tested negative for the mutation
  17 TSC1-57 point 2074C>T 692R>X nonsense mutation   4 familial linked chr9 HD,SSCP 5252 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 17 TSC1-57 point 2074C>T 692R>X nonsense mutation   1 familial     2D-DGGE unknown  
  17 TSC1-32 insertion 2097-2124insNNNNNNNNNNNNNNNNNNNNNNNNNNNN 699H-FS-X in 3'UTR frameshift mutation   2 sporadic     SSCP T7659 28bp insertion, nucleotides not given
  17 TSC1-89 deletion 2102-2105delAGTT 701Q-FS-X early at 722 frameshift mutation   5 sporadic     HD,SSCP 224  
  17 TSC1-90 insertion 2103-2109insGTTACTC 701Q-FS-X early at 707 frameshift mutation   5 familial     HD,SSCP CL5 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.; duplication
  17 TSC1-33 deletion 2107-2108delCT 703L-FS-X early at 704 frameshift mutation   2 sporadic     SSCP T4068  
  17 TSC1-58 deletion 2111-2112delAT 704Y>X frameshift mutation   4 sporadic     HD,SSCP 5566 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 17 TSC1-58 deletion 2111-2112delAT 704Y>X frameshift mutation   1 sporadic     2D-DGGE unknown Found in blinded analysis
  17 TSC1-121 deletion 2111-2112delAT 704Y>X frameshift mutation   6 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., immediate stop codon
  17 TSC1-91 deletion 2144delG 715R-FS-X early at 723 frameshift mutation   5 sporadic     HD,SSCP 319  
c 17 TSC1-91 deletion 2144delG 715R-FS-X early at 723 frameshift mutation   1 sporadic     2D-DGGE 319  
  17 TSC1-151 deletion 2173-2176delAAAG 725K-FS-X early at 735 frameshift mutation   8 sporadic     HD,SSCP unknown  
c 17 TSC1-151 deletion 2173-2176delAAAG 725K-FS-X early at 735 frameshift mutation   1 sporadic     2D-DGGE 12  
  17 TSC1-59 insertion 2174insA 725K-FS-X early at 733 frameshift mutation   4 unknown     HD,SSCP 5296 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
  17 TSC1-122 insertion 2174insA 725K-FS-X early at 733 frameshift mutation   6 familial linked TSC1 linkage or LOH HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  17 TSC1-92 point 2177C>A 726A>E missense polymorphism TS meeting 7/11/98 deletion reported in the same patient 5 sporadic     HD,SSCP 365 originally published as mutation, now known to be polymorphism
c 17 TSC1-92 point 2177C>A 726A>E missense polymorphism   1 sporadic     2D-DGGE 365  
  17 TSC1-43 point 2194C>T 732H>Y missense polymorphism polymorphism status reported in Jones, et al. 3 unknown     SSCP T5100 published as exon15 should be 17
  17 TSC1-44 point 2194C>T 732H>Y missense polymorphism polymorphism status determined by Jones, et al. 2 unknown     SSCP T8775 published as exon 15, should be 17
  17 TSC1-106 point 2194C>T 732H>Y missense polymorphism   5 unknown     HD,SSCP unknown unique in the patient group reported here
  17 TSC1-129 point 2194C>T 732H>Y missense polymorphism   6 unknown     HD,SSCP group 2% het (45 controls or 1/90 control chromosomes)
  17 TSC1-160 point 2194C>T 732H>Y missense polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.006
  18 TSC1-152 point 2227C>T 743Q>X nonsense mutation   8 sporadic     SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 18 TSC1-152 point 2227C>T 743Q>X nonsense mutation   1 sporadic     2D-DGGE 1  
  e18 null point 2250G>A 750W>X nonsense mutation   11 sporadic     HD,SSCP 365 originally this patient was reported to have missense mutation A726E
  18 TSC1-60 point 2283C>G 761Y>X nonsense mutation   4 familial linked chr9 HD,SSCP 5272 no abnormal SSCP pattern, did full sequencing to find this mutation
c 18 TSC1-60 point 2283C>G 761Y>X nonsense mutation   1 familial     2D-DGGE unknown only subtle change on the 1D gel
  18 TSC1-61 point 2293C>T 765Q>X nonsense mutation   4 familial linked chr9 HD,SSCP 5541  
  18 TSC1-123 deletion 2298-2320delGCAGCGTGACACTATGGTAACCA 766E-FS-X early at 777 frameshift mutation   6 sporadic     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  18 TSC1-62 deletion 2319delC 773T-FS-X early at 806 frameshift mutation   4 familial linked chr9 HD,SSCP 5248 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  18 TSC1-34 point 2356C>T 786R>X nonsense mutation   2 familial linked chr9 SSCP T2077  
  18 TSC1-63 point 2356C>T 786R>X nonsense mutation   4 unknown     HD,SSCP 5372 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
  18 TSC1-64 point 2356C>T 786R>X nonsense mutation   4 unknown     HD,SSCP 5487 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
  18 TSC1-93 point 2356C>T 786R>X nonsense mutation   5 sporadic     HD,SSCP 198  
c 18 TSC1-93 point 2356C>T 786R>X nonsense mutation   1 sporadic     2D-DGGE 198  
  18 TSC1-94 point 2356C>T 786R>X nonsense mutation   5 sporadic     HD,SSCP 314  
c 18 TSC1-94 point 2356C>T 786R>X nonsense mutation   1 sporadic     2D-DGGE 314  
  18 TSC1-124 point 2356C>T 786R>X nonsense mutation   6 familial     HD,SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
  18 TSC1-153 point 2356C>T 786R>X nonsense mutation   8 sporadic     SSCP unknown Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 18 TSC1-153 point 2356C>T 786R>X nonsense mutation   1 sporadic     2D-DGGE 2 Point mutation not detected with ABI sequencer, suspected mosaic, leads to new DdeI site
  18 TSC1-65 point 2362G>T 788E>X nonsense mutation   4 familial linked chr9 HD,SSCP 5298 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c 18 TSC1-65 point 2362G>T 788E>X nonsense mutation   1 familial     2D-DGGE unknown Found in blinded analysis
  intron18 TSC1-167 point 2392-35T>C   non-coding polymorphism   1 unknown     2D-DGGE rj2646 (57 in paper) Found in blinded analysis, 2646 refers to another polymorphism position in this patient from Yates/Cambridge
  19 TSC1-95 deletion 2411-2424delGGAACATGATTGCG 804R-FS-X early at 820 frameshift mutation   5 sporadic     HD,SSCP 207  
c 19 TSC1-95 deletion 2411-2424delGGAACATGATTGCG 804R-FS-X early at 820 frameshift mutation   1 sporadic     2D-DGGE 207 Found in blinded analysis
  19 TSC1-130 point 2425G>C 809E>Q missense polymorphism   6 unknown     HD,SSCP group 0% het (56 controls), present in proband & unaffected father
c 19 TSC1-130 point 2425G>C 809E>Q missense polymorphism   1 unknown     2D-DGGE unknown Found in blinded analysis, polymorhpism also found in preceding intron
  19 TSC1-66 deletion 2470-2471delAC 824T>X frameshift mutation   4 unknown     HD,SSCP 5271 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., causes immediate stop, small family
  19 TSC1-125 point 2497C>T 833Q>X nonsense mutation   6 familial linked TSC1 linkage or LOH HD,SSCP unknown  
c 19 TSC1-125 point 2497C>T 833Q>X nonsense mutation   6 familial     2D-DGGE unknown Found in blinded analysis
  intron19 TSC1-67 point 2503-1G>T   splicing mutation   4 familial linked chr9 HD,SSCP 5404 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al.
c intron19 TSC1-67 point 2503-1G>T   splicing mutation   1 familial     2D-DGGE unknown Found in blinded analysis
  20 TSC1-96 point 2507C>G 836S>X nonsense mutation   5 familial     HD,SSCP 74  
c 20 TSC1-96 point 2507C>G 836S>X nonsense mutation   1 familial     2D-DGGE 74  
  20 TSC1-35 deletion 2508-2511delAAAC 836S-FS-X early at 847 frameshift mutation   2 familial     SSCP T5406 Published as 2729delAACA, sequence should be AAAC there, just a shift in the run, doesn't actually make a difference
  20 TSC1-154 deletion 2508-2511delAAAC 836S-FS-X early at 847 frameshift mutation   8 sporadic     HD,SSCP unknown  
c 20 TSC1-154 deletion 2508-2511delAAAC 836S-FS-X early at 847 frameshift mutation   1 sporadic     2D-DGGE 25  
  20 TSC1-168 deletion 2508-2511delAAAC 836S-FS-X early at 847 frameshift mutation   9 familial       unknown reported as 2730del4 in the table, but this is equivalent due to an A run, and puts it with the others at the position
  20 TSC1-68 insertion 2509insA 837N-FS-X early at 839 frameshift mutation   4 unknown     HD,SSCP 5331 Also reported in Science (1997) 277:805-808, vanSlegtenhorst et al., small family
  20 TSC1-69 deletion 2528-2534delAGCAGAT 843Q-FS-X early at 846 frameshift mutation   4 familial linked chr9 HD,SSCP 5527  
  20 TSC1-36 deletion 2566delG 856G-FS-X early at 877 frameshift mutation   2 familial     SSCP T1295  
  intron20 TSC1-107 deletion 2626-4delT   deletion in non-coding polymorphism   5 unknown     HD,SSCP group five alleles here of 17-21monomer T runs (20 in reference) frequencies of 1.6-57%
  21 TSC1-131 point 2646C>T 882A silent polymorphism   6 unknown     HD,SSCP group 0% het (67 controls, or 0/134 normal chromosomes), observed in 2 unrelated patients, not expected to have an effect on splicing
c 21 TSC1-131 point 2646C>T 882A silent polymorphism   1 unknown     2D-DGGE unknown Found in blinded analysis
  21 TSC1-97 insertion 2650insT 884Y-FS-X early at 903 frameshift mutation   5 familial     HD,SSCP CL2  
  21 TSC1-70 insertion 2666insA 889E-FS-X early at 903 frameshift mutation   4 unknown     HD,SSCP 5408 small family
  21 TSC1-71 insertion 2666insA 889E-FS-X early at 903 frameshift mutation   4 familial linked chr9 HD,SSCP 5349  
  21 TSC1-98 insertion 2666insA 889E-FS-X early at 903 frameshift mutation   5 sporadic     HD,SSCP 108  
c 21 TSC1-98 insertion 2666insA 889E-FS-X early at 903 frameshift mutation   1 sporadic     2D-DGGE 108 Found in blinded analysis
  21 TSC1-126 insertion 2666insA 889E-FS-X early at 903 frameshift mutation   6 sporadic     HD,SSCP unknown  
  21 TSC1-99 deletion 2674-2675delAG 892R-FS-X early at 902 frameshift mutation   5 sporadic     HD,SSCP 161  
c 21 TSC1-99 deletion 2674-2675delAG 892R-FS-X early at 902 frameshift mutation   1 sporadic     2D-DGGE 161 Found in blinded analysis
  21 TSC1-72 point 2692C>T 898Q>X nonsense mutation   4 unknown     HD,SSCP 5441 small family
  22 TSC1-6 point 2829C>T 943A silent polymorphism   1 unknown     2D-DGGE group seen in 12/63 cases, het 0.190
  22 TSC1-45 point 2829C>T 943A silent polymorphism   2 unknown     SSCP T1219  
  22 TSC1-108 point 2829C>T 943A silent polymorphism   5 unknown     HD,SSCP group rare allele frequency 10%
  22 TSC1-132 point 2829C>T 943A silent polymorphism   6 unknown     HD,SSCP group 18% het (71 controls), present in 20% of the patients
  22 TSC1-161 point 2829C>T 943A silent polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.075
  23 TSC1-7 point 3103G>A 1035G>S missense polymorphism   1 unknown     2D-DGGE group seen in 2/63 patients, het 0.032
  23 TSC1-77 point 3103G>A 1035G>S missense polymorphism   4 unknown     HD,SSCP group Approx. allele frequency 0.6
  23 TSC1-109 point 3103G>A 1035G>S missense polymorphism   5 unknown     HD,SSCP unknown unique in this set of patients
  23 TSC1-162 point 3103G>A 1035G>S missense polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.003
  23 TSC1-110 point 3282G>A 1094E silent polymorphism   5 unknown     HD,SSCP unknown unique to this set of patients
  23 TSC1-163 point 3282G>A 1094E silent polymorphism seen in one or more unaffected parents/controls 8 unknown       group rare allele freq 0.003
c 23 TSC1-163 point 3282G>A 1094E silent polymorphism   1 unknown     2D-DGGE 7  
  23 TSC1-164 point 3322G>A 1108G>S missense polymorphism   18 unknown       group rare allele freq 0.003; parents not available but missense is conserved and it occurs in a region no other TSC1 mutations have been identified
c 23 TSC1-164 point 3322G>A 1108G>S missense polymorphism   1 unknown     2D-DGGE 25  

Last Updated on 8/8/99
By Mary Pat Reeve